Product Details

SNP ID: rs762088
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24079150 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTTTTTAAGTATACTCAGGTAACC[C/G]AGGAGTATCATTTTGAGACCCAGGT
Phenotype: MIM: 614716 MIM: 605688 MIM: 162080
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CARMIL3 PubMed Links

Gene Details

Gene: CARMIL3
Gene Name: capping protein regulator and myosin 1 linker 3

There are no transcripts associated with this gene.

Gene: CPNE6
Gene Name: copine 6

There are no transcripts associated with this gene.

Gene: NRL
Gene Name: neural retina leucine zipper

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006177.3	2715	Intron			NP_006168.1
XM_005267708.4	2715	UTR 3			XP_005267765.1
XM_005267709.3	2715	UTR 3			XP_005267766.1
XM_005267710.3	2715	UTR 3			XP_005267767.1
XM_011536801.2	2715	UTR 3			XP_011535103.2
XM_011536802.1	2715	UTR 3			XP_011535104.1
XM_011536804.2	2715	UTR 3			XP_011535106.1
XM_011536805.2	2715	UTR 3			XP_011535107.1
XM_011536806.2	2715	UTR 3			XP_011535108.2
XM_017021350.1	2715	UTR 3			XP_016876839.1

View Full Product Details