Product Details

SNP ID: rs13483306
Assay Type: Pre Designed
NCBI dbSNP Submissions: NA
Location: Chr.18:37690719 on Build GRCm38
Set Membership
Context Sequence [VIC/FAM]: TCAGTGTCACCCTTCGGGAGGATGT[A/G]CCACCAGGCTTCTCCGTGCTTCAGG
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: Gm37013 PubMed Links

Gene Details

Gene: Gm37013
Gene Name: predicted gene, 37013

There are no transcripts associated with this gene.

Gene: Gm38666
Gene Name: predicted gene, 38666

There are no transcripts associated with this gene.

Gene: Pcdha7-g
Gene Name: protocadherin alpha 7-gamma

There are no transcripts associated with this gene.

Gene: Pcdhga1
Gene Name: protocadherin gamma subfamily A, 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033584.1	861	Intron			NP_291062.1

Gene: Pcdhga2
Gene Name: protocadherin gamma subfamily A, 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033585.1	861	Intron			NP_291063.1

Gene: Pcdhga3
Gene Name: protocadherin gamma subfamily A, 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033586.2	861	Intron			NP_291064.1

Gene: Pcdhga4
Gene Name: protocadherin gamma subfamily A, 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033587.3	861	Intron			NP_291065.3

Gene: Pcdhga5
Gene Name: protocadherin gamma subfamily A, 5

There are no transcripts associated with this gene.

Gene: Pcdhgb1
Gene Name: protocadherin gamma subfamily B, 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033574.3	861	Intron			NP_291052.3

Gene: Pcdhgb2
Gene Name: protocadherin gamma subfamily B, 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033575.3	861	Silent Mutation			NP_291053.1

View Full Product Details