Product Details

SNP ID
rs79063860
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.5:38940069 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TAACCACAAAGCTCTGAGTATCTCC[A/C]CAAAGTAAGTGATATAGGCAGATAT
Phenotype
MIM: 601743 MIM: 609022
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
OSMR PubMed Links
Additional Information
For this assay, SNP(s) [rs149159011] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
OSMR
Gene Name
oncostatin M receptor
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001168355.2 7277 Intron NP_001161827.1
NM_001323504.1 7277 Intron NP_001310433.1
NM_001323505.1 7277 Intron NP_001310434.1
NM_001323506.1 7277 Intron NP_001310435.1
NM_001323507.1 7277 Intron NP_001310436.1
NM_003999.2 7277 Intron NP_003990.1
XM_005248384.1 7277 Intron XP_005248441.1
XM_005248386.2 7277 Intron XP_005248443.1
XM_005248387.2 7277 Intron XP_005248444.1
XM_011514161.2 7277 Intron XP_011512463.1
XM_017010019.1 7277 Intron XP_016865508.1
XM_017010020.1 7277 Intron XP_016865509.1
Gene
RICTOR
Gene Name
RPTOR independent companion of MTOR complex 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001285439.1 7277 UTR 3 NP_001272368.1
NM_001285440.1 7277 UTR 3 NP_001272369.1
NM_152756.4 7277 UTR 3 NP_689969.2
XM_006714463.3 7277 UTR 3 XP_006714526.1
XM_011514005.2 7277 UTR 3 XP_011512307.1
XM_011514006.2 7277 UTR 3 XP_011512308.1
XM_017009311.1 7277 UTR 3 XP_016864800.1
XM_017009312.1 7277 UTR 3 XP_016864801.1
XM_017009313.1 7277 UTR 3 XP_016864802.1
XM_017009314.1 7277 UTR 3 XP_016864803.1
XM_017009315.1 7277 UTR 3 XP_016864804.1

View Full Product Details