Product Details

SNP ID
rs76655359
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.10:31330861 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ACTTTTCTGTTTTATTTTATCACCT[A/G]TTCCTATTCCTTGAAAATTCGTTAT
Phenotype
MIM: 189909
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
ZEB1 PubMed Links
Additional Information
For this assay, SNP(s) [rs151276952] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ZEB1
Gene Name
zinc finger E-box binding homeobox 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001128128.2 Intron NP_001121600.1
NM_001174093.1 Intron NP_001167564.1
NM_001174094.1 Intron NP_001167565.1
NM_001174095.1 Intron NP_001167566.1
NM_001174096.1 Intron NP_001167567.1
NM_001323638.1 Intron NP_001310567.1
NM_001323641.1 Intron NP_001310570.1
NM_001323642.1 Intron NP_001310571.1
NM_001323643.1 Intron NP_001310572.1
NM_001323644.1 Intron NP_001310573.1
NM_001323645.1 Intron NP_001310574.1
NM_001323646.1 Intron NP_001310575.1
NM_001323647.1 Intron NP_001310576.1
NM_001323648.1 Intron NP_001310577.1
NM_001323649.1 Intron NP_001310578.1
NM_001323650.1 Intron NP_001310579.1
NM_001323651.1 Intron NP_001310580.1
NM_001323652.1 Intron NP_001310581.1
NM_001323653.1 Intron NP_001310582.1
NM_001323654.1 Intron NP_001310583.1
NM_001323655.1 Intron NP_001310584.1
NM_001323656.1 Intron NP_001310585.1
NM_001323657.1 Intron NP_001310586.1
NM_001323658.1 Intron NP_001310587.1
NM_001323659.1 Intron NP_001310588.1
NM_001323660.1 Intron NP_001310589.1
NM_001323661.1 Intron NP_001310590.1
NM_001323662.1 Intron NP_001310591.1
NM_001323663.1 Intron NP_001310592.1
NM_001323664.1 Intron NP_001310593.1
NM_001323665.1 Intron NP_001310594.1
NM_001323666.1 Intron NP_001310595.1
NM_001323671.1 Intron NP_001310600.1
NM_001323672.1 Intron NP_001310601.1
NM_001323673.1 Intron NP_001310602.1
NM_001323674.1 Intron NP_001310603.1
NM_001323675.1 Intron NP_001310604.1
NM_001323676.1 Intron NP_001310605.1
NM_001323677.1 Intron NP_001310606.1
NM_001323678.1 Intron NP_001310607.1
NM_030751.5 Intron NP_110378.3
XM_006717498.2 Intron XP_006717561.1
XM_011519643.2 Intron XP_011517945.1
XM_017016597.1 Intron XP_016872086.1
XM_017016598.1 Intron XP_016872087.1
XM_017016599.1 Intron XP_016872088.1
XM_017016600.1 Intron XP_016872089.1
XM_017016601.1 Intron XP_016872090.1
XM_017016602.1 Intron XP_016872091.1
XM_017016603.1 Intron XP_016872092.1

View Full Product Details