Product Details

SNP ID

rs80355554

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.11:45933232 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ACAGCGGGATAACCACGGAGATGCG[C/T]GACTCACCAAGCAGGGAAGGAAGGA

Phenotype

MIM: 609709 MIM: 608325

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

LARGE2 PubMed Links

Gene Details

Gene

LARGE2

Gene Name

LARGE xylosyl- and glucuronyltransferase 2

There are no transcripts associated with this gene.

Gene

PHF21A

Gene Name

PHD finger protein 21A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001101802.1	3302	UTR 3			NP_001095272.1
NM_016621.3	3302	UTR 3			NP_057705.3
XM_005252965.4	3302	UTR 3			XP_005253022.1
XM_011520157.2	3302	UTR 3			XP_011518459.1
XM_011520158.2	3302	UTR 3			XP_011518460.1
XM_011520160.2	3302	UTR 3			XP_011518462.1
XM_011520161.2	3302	UTR 3			XP_011518463.1
XM_011520162.2	3302	UTR 3			XP_011518464.1
XM_011520164.2	3302	UTR 3			XP_011518466.1
XM_011520165.2	3302	UTR 3			XP_011518467.1
XM_011520166.2	3302	UTR 3			XP_011518468.1
XM_011520167.2	3302	UTR 3			XP_011518469.1
XM_011520168.2	3302	UTR 3			XP_011518470.1
XM_011520169.2	3302	UTR 3			XP_011518471.1
XM_011520173.2	3302	UTR 3			XP_011518475.1
XM_011520174.2	3302	UTR 3			XP_011518476.1
XM_011520175.2	3302	UTR 3			XP_011518477.1
XM_011520179.2	3302	UTR 3			XP_011518481.1
XM_017017885.1	3302	UTR 3			XP_016873374.1
XM_017017886.1	3302	UTR 3			XP_016873375.1
XM_017017887.1	3302	UTR 3			XP_016873376.1
XM_017017888.1	3302	UTR 3			XP_016873377.1
XM_017017889.1	3302	UTR 3			XP_016873378.1
XM_017017890.1	3302	UTR 3			XP_016873379.1
XM_017017891.1	3302	UTR 3			XP_016873380.1
XM_017017892.1	3302	UTR 3			XP_016873381.1
XM_017017893.1	3302	UTR 3			XP_016873382.1
XM_017017894.1	3302	UTR 3			XP_016873383.1
XM_017017895.1	3302	UTR 3			XP_016873384.1
XM_017017896.1	3302	UTR 3			XP_016873385.1
XM_017017897.1	3302	UTR 3			XP_016873386.1
XM_017017898.1	3302	UTR 3			XP_016873387.1
XM_017017899.1	3302	UTR 3			XP_016873388.1
XM_017017900.1	3302	UTR 3			XP_016873389.1
XM_017017901.1	3302	UTR 3			XP_016873390.1
XM_017017902.1	3302	UTR 3			XP_016873391.1
XM_017017903.1	3302	UTR 3			XP_016873392.1
XM_017017904.1	3302	Intron			XP_016873393.1
XM_017017905.1	3302	UTR 3			XP_016873394.1
XM_017017906.1	3302	Intron			XP_016873395.1
XM_017017907.1	3302	UTR 3			XP_016873396.1
XM_017017908.1	3302	UTR 3			XP_016873397.1

View Full Product Details