Product Details

SNP ID: rs78651634
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:123253718 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTCATTTTCCTACACCACTGACCC[A/G]AATATGCCCGGCGCCATGGGGACTC
Phenotype: MIM: 613541 MIM: 602198 MIM: 605501
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C12orf65 PubMed Links

Gene Details

Gene: C12orf65
Gene Name: chromosome 12 open reading frame 65

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001143905.2	307	Missense Mutation	CAA,CGA	Q15R	NP_001137377.1
NM_001194995.1	307	Missense Mutation	CAA,CGA	Q15R	NP_001181924.1
NM_152269.4	307	Missense Mutation	CAA,CGA	Q15R	NP_689482.1
XM_005253630.4	307	Missense Mutation	CAA,CGA	Q15R	XP_005253687.1
XM_011538980.2	307	Missense Mutation	CAA,CGA	Q15R	XP_011537282.1

Gene: CDK2AP1
Gene Name: cyclin dependent kinase 2 associated protein 1

There are no transcripts associated with this gene.

Gene: MPHOSPH9
Gene Name: M-phase phosphoprotein 9

There are no transcripts associated with this gene.

View Full Product Details