Product Details

SNP ID

rs75005894

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.16:48170166 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CAGCTGCCTCTCCCCCACAGAGAAG[A/T]TTCCACCGTTTTCCACCACATCTGT

Phenotype

MIM: 607040

Polymorphism

A/T, Transversion Substitution

Allele Nomenclature

Literature Links

ABCC11 PubMed Links

Additional Information

For this assay, SNP(s) [rs61739606] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ABCC11

Gene Name

ATP binding cassette subfamily C member 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032583.3	4180	Missense Mutation	AAC,ATC	N1277I	NP_115972.2
NM_033151.3	4180	Missense Mutation	AAC,ATC	N1277I	NP_149163.2
NM_145186.2	4180	Intron			NP_660187.1
XM_011523397.1	4180	Missense Mutation	AAC,ATC	N958I	XP_011521699.1
XM_011523398.2	4180	Missense Mutation	AAC,ATC	N654I	XP_011521700.1
XM_017023795.1	4180	Missense Mutation	AAC,ATC	N1277I	XP_016879284.1
XM_017023796.1	4180	Missense Mutation	AAC,ATC	N1277I	XP_016879285.1
XM_017023797.1	4180	Missense Mutation	AAC,ATC	N1277I	XP_016879286.1
XM_017023798.1	4180	Missense Mutation	AAC,ATC	N1277I	XP_016879287.1
XM_017023799.1	4180	Missense Mutation	AAC,ATC	N1277I	XP_016879288.1
XM_017023800.1	4180	Missense Mutation	AAC,ATC	N1277I	XP_016879289.1
XM_017023801.1	4180	Missense Mutation	AAC,ATC	N1241I	XP_016879290.1
XM_017023802.1	4180	Missense Mutation	AAC,ATC	N958I	XP_016879291.1
XM_017023803.1	4180	Intron			XP_016879292.1

View Full Product Details