Product Details

SNP ID: rs79003983
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:20112798 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTAGATGGGGCTCTGCAGAGGCTG[T/G]GGGGGGAAAAGGGGGGCGCTAAGGT
Phenotype: MIM: 609030 MIM: 601180 MIM: 611151
Polymorphism: T/G, Transversion substitution
Allele Nomenclature
Literature Links: DGCR8 PubMed Links

Gene Details

Gene: DGCR8
Gene Name: DGCR8 microprocessor complex subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190326.1	2054	Intron			NP_001177255.1
NM_022720.6	2054	Intron			NP_073557.3
XM_006724268.2	2054	Intron			XP_006724331.1

Gene: MIR6816
Gene Name: microRNA 6816

There are no transcripts associated with this gene.

Gene: RANBP1
Gene Name: RAN binding protein 1

There are no transcripts associated with this gene.

Gene: TRMT2A
Gene Name: tRNA methyltransferase 2 homolog A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001257994.1	2054	Silent Mutation	CCA,CCC	P555P	NP_001244923.1
NM_022727.5	2054	Intron			NP_073564.3
NM_182984.4	2054	Intron			NP_892029.2
XM_011530139.2	2054	Intron			XP_011528441.1
XM_011530141.1	2054	Intron			XP_011528443.1
XM_011530142.2	2054	Intron			XP_011528444.1
XM_017028770.1	2054	Intron			XP_016884259.1

View Full Product Details