Product Details

SNP ID: rs79181273
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.4:183446452 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGAAATCCAGTGTGAATAGTCACAT[G/T]ACCCAATCCACTGATTCTAGACAAC
Phenotype: MIM: 615914
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: CDKN2AIP PubMed Links
Additional Information: For this assay, SNP(s) [rs147291711] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317343.1	944	UTR 3			NP_001304272.1
NM_017632.3	944	Missense Mutation	ATG,ATT	M256I	NP_060102.1