Product Details

SNP ID: rs80269731
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:83456981 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGTAAGAATTTTTTTTTCTATTA[A/G]TAAGGCCTTTGCAAATATGACCAAA
Phenotype: MIM: 611143 MIM: 606769 MIM: 611983
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM175A PubMed Links

Gene Details

Gene: FAM175A
Gene Name: family with sequence similarity 175 member A

There are no transcripts associated with this gene.

Gene: HELQ
Gene Name: helicase, POLQ-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297755.1		Intron			NP_001284684.1
NM_001297756.1		Intron			NP_001284685.1
NM_001297757.1		Intron			NP_001284686.1
NM_001297758.1		Intron			NP_001284687.1
NM_001297759.1		Intron			NP_001284688.1
NM_133636.3		Intron			NP_598375.2

Gene: MRPS18C
Gene Name: mitochondrial ribosomal protein S18C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297767.1		Intron			NP_001284696.1
NM_001297769.1		Intron			NP_001284698.1
NM_001297770.1		Intron			NP_001284699.1
NM_016067.3		Intron			NP_057151.1

View Full Product Details