Product Details

SNP ID: rs79922429
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:176392792 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGCACCTAGCGGGACAGTGGCGT[C/T]TGCTTCAGGGACATGAGCACCGAGC
Phenotype: MIM: 118970 MIM: 612861
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARL10 PubMed Links

Gene Details

Gene: ARL10
Gene Name: ADP ribosylation factor like GTPase 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317948.1	823	Intron			NP_001304877.1
NM_173664.5	823	Intron			NP_775935.1
XM_011534529.2	823	Intron			XP_011532831.1
XM_011534530.2	823	Intron			XP_011532832.1
XM_011534531.2	823	Intron			XP_011532833.1
XM_017009372.1	823	Intron			XP_016864861.1

Gene: CLTB
Gene Name: clathrin light chain B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001834.3	823	Silent Mutation	CAA,CAG	Q206Q	NP_001825.1
NM_007097.3	823	Silent Mutation	CAA,CAG	Q224Q	NP_009028.1
XM_017009026.1	823	Silent Mutation	CAA,CAG	Q139Q	XP_016864515.1
XM_017009027.1	823	Intron			XP_016864516.1

Gene: HIGD2A
Gene Name: HIG1 hypoxia inducible domain family member 2A

There are no transcripts associated with this gene.

Gene: NOP16
Gene Name: NOP16 nucleolar protein

There are no transcripts associated with this gene.

View Full Product Details