Product Details

SNP ID: rs77932721
Assay Type: Functionally tested
NCBI dbSNP Submissions: 20
Location: Chr.1:45344272 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTGAATAGGTTAGCTAAGAGCCAT[G/T]ACCACCACGCTGCCTTGCTGTCCCC
Phenotype: MIM: 604933 MIM: 604746 MIM: 613931
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: MUTYH PubMed Links

Gene Details

Gene: MUTYH
Gene Name: mutY DNA glycosylase

There are no transcripts associated with this gene.

Gene: TESK2
Gene Name: testis-specific kinase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320800.1	3015	UTR 3			NP_001307729.1
NM_007170.2	3015	UTR 3			NP_009101.2
XM_005270355.3	3015	UTR 3			XP_005270412.1
XM_006710287.2	3015	UTR 3			XP_006710350.1
XM_011540497.1	3015	UTR 3			XP_011538799.1
XM_011540500.2	3015	Intron			XP_011538802.1
XM_017000047.1	3015	UTR 3			XP_016855536.1
XM_017000048.1	3015	UTR 3			XP_016855537.1
XM_017000049.1	3015	UTR 3			XP_016855538.1

Gene: TOE1
Gene Name: target of EGR1, member 1 (nuclear)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025077.3	3015	Intron			NP_079353.3
XM_005270412.3	3015	Intron			XP_005270469.1
XM_005270413.4	3015	Intron			XP_005270470.1
XM_011540569.2	3015	Intron			XP_011538871.1

View Full Product Details