Product Details

SNP ID

rs112543214

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.2:240560766 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GGTGCGCGTCGCGCCCTCACTCTTC[C/T]TCGGGAGCGCGCGAGCCGCGGGCGC

Phenotype

MIM: 605287

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANKMY1 PubMed Links

Gene Details

Gene

ANKMY1

Gene Name

ankyrin repeat and MYND domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282771.1	290	Intron			NP_001269700.1
NM_001282780.1	290	Intron			NP_001269709.1
NM_001282781.1	290	Intron			NP_001269710.1
NM_001308375.1	290	Missense Mutation	AAG,AGG	K62R	NP_001295304.1
NM_016552.3	290	Intron			NP_057636.2
NM_017844.3	290	Intron			NP_060314.2
XM_011511300.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509602.1
XM_011511301.1	290	Missense Mutation	AAG,AGG	K62R	XP_011509603.1
XM_011511304.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509606.1
XM_011511305.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509607.1
XM_011511309.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509611.1
XM_011511313.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509615.1
XM_011511315.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509617.1
XM_011511317.1	290	Missense Mutation	AAG,AGG	K62R	XP_011509619.1
XM_011511318.1	290	Missense Mutation	AAG,AGG	K62R	XP_011509620.1
XM_011511319.2	290	Missense Mutation	AAG,AGG	K62R	XP_011509621.1
XM_011511322.1	290	Missense Mutation	AAG,AGG	K62R	XP_011509624.1
XM_017004271.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859760.1
XM_017004272.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859761.1
XM_017004273.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859762.1
XM_017004274.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859763.1
XM_017004275.1	290	Intron			XP_016859764.1
XM_017004276.1	290	UTR 5			XP_016859765.1
XM_017004277.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859766.1
XM_017004278.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859767.1
XM_017004279.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859768.1
XM_017004280.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859769.1
XM_017004281.1	290	Intron			XP_016859770.1
XM_017004282.1	290	UTR 5			XP_016859771.1
XM_017004283.1	290	UTR 5			XP_016859772.1
XM_017004284.1	290	Missense Mutation	AAG,AGG	K62R	XP_016859773.1
XM_017004285.1	290	Intron			XP_016859774.1
XM_017004286.1	290	UTR 5			XP_016859775.1
XM_017004287.1	290	UTR 5			XP_016859776.1
XM_017004288.1	290	UTR 5			XP_016859777.1
XM_017004289.1	290	UTR 5			XP_016859778.1
XM_017004290.1	290	UTR 5			XP_016859779.1
XM_017004291.1	290	UTR 5			XP_016859780.1

Gene

DUSP28

Gene Name

dual specificity phosphatase 28

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033575.1	290	Missense Mutation	CTC,TTC	L28F	NP_001028747.1

Gene

RNPEPL1

Gene Name

arginyl aminopeptidase like 1

There are no transcripts associated with this gene.

View Full Product Details