Product Details

SNP ID: rs111583867
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:44052865 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCAACCTGGGCATCCTTGTGTTGC[A/G]GACAGGCGAGGGCGTGAACGATGTG
Phenotype: MIM: 610106 MIM: 612931
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DBNL PubMed Links

Gene Details

Gene: DBNL
Gene Name: drebrin like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014436.2		Intron			NP_001014436.1
NM_001122956.1		Intron			NP_001116428.1
NM_001284313.1		Intron			NP_001271242.1
NM_001284315.1		Intron			NP_001271244.1
NM_014063.6		Intron			NP_054782.2
XM_011515325.1		Intron			XP_011513627.1

Gene: LINC00957
Gene Name: long intergenic non-protein coding RNA 957

There are no transcripts associated with this gene.

Gene: MIR6837
Gene Name: microRNA 6837

There are no transcripts associated with this gene.

Gene: PGAM2
Gene Name: phosphoglycerate mutase 2

There are no transcripts associated with this gene.

View Full Product Details