Product Details

SNP ID
rs113310260
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.9:81584291 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CAGAGATGTCACAGCTAAGCACTGA[C/T]GAGGACTCTTTGGACTGGAAGAGAA
Phenotype
MIM: 600189
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
TLE1 PubMed Links
Additional Information
For this assay, SNP(s) [rs549010195] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
TLE1
Gene Name
transducin like enhancer of split 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001303103.1 2456 Silent Mutation NP_001290032.1
NM_001303104.1 2456 Silent Mutation NP_001290033.1
NM_005077.4 2456 Silent Mutation NP_005068.2
XM_005252151.1 2456 Silent Mutation XP_005252208.1
XM_005252152.1 2456 Silent Mutation XP_005252209.1
XM_005252153.1 2456 Silent Mutation XP_005252210.1
XM_005252154.1 2456 Silent Mutation XP_005252211.1
XM_005252156.2 2456 Silent Mutation XP_005252213.1
XM_005252162.1 2456 Silent Mutation XP_005252219.1
XM_005252163.2 2456 Silent Mutation XP_005252220.1
XM_006717258.1 2456 Silent Mutation XP_006717321.1
XM_006717259.3 2456 Silent Mutation XP_006717322.1
XM_006717260.1 2456 Silent Mutation XP_006717323.1
XM_006717261.2 2456 Silent Mutation XP_006717324.1
XM_006717262.1 2456 Silent Mutation XP_006717325.1
XM_006717263.1 2456 Silent Mutation XP_006717326.1
XM_011518951.2 2456 Silent Mutation XP_011517253.1
XM_017015064.1 2456 Silent Mutation XP_016870553.1
XM_017015065.1 2456 Silent Mutation XP_016870554.1
XM_017015066.1 2456 Silent Mutation XP_016870555.1

View Full Product Details