Product Details

SNP ID: rs113627401
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2971237 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTGGGCAAGGATGGCTGGCTGGGA[A/G]GCACACATTGCGTGGCCTGCCTTGC
Phenotype: MIM: 609899 MIM: 614578 MIM: 602474
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KREMEN2 PubMed Links

Gene Details

Gene: KREMEN2
Gene Name: kringle containing transmembrane protein 2

There are no transcripts associated with this gene.

Gene: PAQR4
Gene Name: progestin and adipoQ receptor family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284511.1	677	Intron			NP_001271440.1
NM_001284512.1	677	Intron			NP_001271441.1
NM_001284513.1	677	Missense Mutation	AGC,GGC	S16G	NP_001271442.1
NM_001324118.1	677	Missense Mutation	AGC,GGC	S83G	NP_001311047.1
NM_152341.4	677	Missense Mutation	AGC,GGC	S83G	NP_689554.2

Gene: PKMYT1
Gene Name: protein kinase, membrane associated tyrosine/threonine 1

There are no transcripts associated with this gene.

View Full Product Details