Product Details

SNP ID: rs115692989
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:798082 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCTTTACAGACTGTAATCACGTG[C/G]GAGTGGAGTGGGGTTCACAGGATGG
Phenotype: MIM: 613201 MIM: 607298
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CHTF18 PubMed Links

Gene Details

Gene: CHTF18
Gene Name: chromosome transmission fidelity factor 18

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022092.2	943	Intron			NP_071375.1
XM_005255470.1	943	Intron			XP_005255527.1
XM_005255471.3	943	Intron			XP_005255528.1
XM_011522572.1	943	Intron			XP_011520874.1
XM_011522573.1	943	Intron			XP_011520875.1
XM_017023532.1	943	Intron			XP_016879021.1
XM_017023533.1	943	Intron			XP_016879022.1
XM_017023534.1	943	Intron			XP_016879023.1

Gene: GNG13
Gene Name: G protein subunit gamma 13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016541.2	943	UTR 3			NP_057625.1

Gene: PRR25
Gene Name: proline rich 25

There are no transcripts associated with this gene.

Gene: RPUSD1
Gene Name: RNA pseudouridylate synthase domain containing 1

There are no transcripts associated with this gene.

View Full Product Details