Product Details

SNP ID: rs111833428
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:44907785 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGCCAGGCCAAGGTGGAGCAAGC[A/G]GTGGAGACAGAGCCGGAGCCCGAGC
Phenotype: MIM: 107710 MIM: 107741 MIM: 608061
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APOC1 PubMed Links

Gene Details

Gene: APOC1
Gene Name: apolipoprotein C1

There are no transcripts associated with this gene.

Gene: APOE
Gene Name: apolipoprotein E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000041.3	267	Silent Mutation	GCA,GCG	A23A	NP_000032.1
NM_001302688.1	267	Silent Mutation	GCA,GCG	A49A	NP_001289617.1
NM_001302689.1	267	Silent Mutation	GCA,GCG	A23A	NP_001289618.1
NM_001302690.1	267	Silent Mutation	GCA,GCG	A23A	NP_001289619.1
NM_001302691.1	267	Silent Mutation	GCA,GCG	A23A	NP_001289620.1

Gene: TOMM40
Gene Name: translocase of outer mitochondrial membrane 40

There are no transcripts associated with this gene.

View Full Product Details