Product Details

SNP ID: rs113934432
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:50423007 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAGGCCCCGGGGCCTGGCCTCCC[CC/TG]CATACCCCACGGAGAACTTCGCTA
Phenotype: MIM: 160793 MIM: 174761 MIM: 606802
Polymorphism: CC/TG, Multiple nucleotide polymorphism
Allele Nomenclature
Literature Links: MYBPC2 PubMed Links

Gene Details

Gene: MYBPC2
Gene Name: myosin binding protein C, fast type

There are no transcripts associated with this gene.

Gene: POLD1
Gene Name: DAN polymerase delta 1, catalytic subunit

There are no transcripts associated with this gene.

Gene: SPIB
Gene Name: Spi-B transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243998.1	334	Intron			NP_001230927.1
NM_001243999.1	334	Missense Mutation			NP_001230928.1
NM_001244000.1	334	Silent Mutation			NP_001230929.1
NM_003121.4	334	Missense Mutation			NP_003112.2

View Full Product Details