Product Details

SNP ID: rs114668300
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:39141917 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTACAAGGTGTTCCCACAAGCACA[C/T]AGGCTGGCAAGGCCTCCTGGGCAAG
Phenotype: MIM: 606458 MIM: 611430
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CSRNP1 PubMed Links

Gene Details

Gene: CSRNP1
Gene Name: cysteine and serine rich nuclear protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320559.1	3122	UTR 3			NP_001307488.1
NM_001320560.1	3122	UTR 3			NP_001307489.1
NM_033027.3	3122	UTR 3			NP_149016.2
XM_017007048.1	3122	UTR 3			XP_016862537.1
XM_017007049.1	3122	UTR 3			XP_016862538.1

Gene: MIR6822
Gene Name: microRNA 6822

There are no transcripts associated with this gene.

Gene: TTC21A
Gene Name: tetratricopeptide repeat domain 21A

There are no transcripts associated with this gene.

View Full Product Details