Product Details

SNP ID
rs112106325
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.10:73813914 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCTGAGGCCACCACTTCTCAGCTGC[C/T]TCCACAGCAGGCTGGGAGCTCTGCG
Phenotype
MIM: 602123 MIM: 603268
Polymorphism
C/T, Transition substitution
Allele Nomenclature
Literature Links
CAMK2G PubMed Links

Gene Details

Gene
CAMK2G
Gene Name
calcium/calmodulin dependent protein kinase II gamma
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001204492.1 2315 UTR 3 NP_001191421.1
NM_001222.3 2315 UTR 3 NP_001213.2
NM_001320898.1 2315 Intron NP_001307827.1
NM_172169.2 2315 UTR 3 NP_751909.1
NM_172170.4 2315 UTR 3 NP_751910.1
NM_172171.2 2315 UTR 3 NP_751911.1
NM_172173.2 2315 UTR 3 NP_751913.1
XM_005270195.1 2315 UTR 3 XP_005270252.1
XM_005270197.1 2315 UTR 3 XP_005270254.1
XM_005270198.1 2315 UTR 3 XP_005270255.1
XM_005270199.1 2315 UTR 3 XP_005270256.1
XM_005270200.1 2315 UTR 3 XP_005270257.1
XM_005270201.1 2315 UTR 3 XP_005270258.1
XM_005270203.1 2315 UTR 3 XP_005270260.1
XM_005270205.1 2315 UTR 3 XP_005270262.1
XM_006717993.1 2315 UTR 3 XP_006718056.1
XM_006717996.1 2315 UTR 3 XP_006718059.1
XM_006717997.1 2315 UTR 3 XP_006718060.1
XM_006717998.1 2315 UTR 3 XP_006718061.1
XM_011540225.2 2315 Intron XP_011538527.1
XM_017016716.1 2315 Intron XP_016872205.1
XM_017016717.1 2315 Intron XP_016872206.1
XM_017016718.1 2315 Intron XP_016872207.1
XM_017016719.1 2315 Intron XP_016872208.1
XM_017016720.1 2315 Intron XP_016872209.1
XM_017016721.1 2315 Intron XP_016872210.1
XM_017016722.1 2315 Intron XP_016872211.1
XM_017016723.1 2315 Intron XP_016872212.1
XM_017016724.1 2315 Intron XP_016872213.1
XM_017016725.1 2315 Intron XP_016872214.1
XM_017016726.1 2315 Intron XP_016872215.1
XM_017016727.1 2315 Intron XP_016872216.1
XM_017016728.1 2315 UTR 3 XP_016872217.1
XM_017016729.1 2315 Intron XP_016872218.1
XM_017016730.1 2315 UTR 3 XP_016872219.1
XM_017016731.1 2315 Intron XP_016872220.1
XM_017016732.1 2315 Intron XP_016872221.1
XM_017016733.1 2315 UTR 3 XP_016872222.1
XM_017016734.1 2315 Intron XP_016872223.1
XM_017016735.1 2315 UTR 3 XP_016872224.1
XM_017016736.1 2315 UTR 3 XP_016872225.1
XM_017016737.1 2315 Intron XP_016872226.1
XM_017016738.1 2315 Intron XP_016872227.1
XM_017016739.1 2315 Intron XP_016872228.1
Gene
NDST2
Gene Name
N-deacetylase and N-sulfotransferase 2
There are no transcripts associated with this gene.

View Full Product Details