Product Details

SNP ID: rs112631171
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:86970198 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTAAAAGCCACATCTCTCTGTTCC[A/C]GTGTCAGCGGCCGGAGCGGCAGCTC
Phenotype: MIM: 608925 MIM: 602998
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ADIRF PubMed Links

Gene Details

Gene: ADIRF
Gene Name: adipogenesis regulatory factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006829.2	1114	Intron			NP_006820.1

Gene: AGAP11
Gene Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_133447.1	1114	Intron			NP_597704.1

Gene: MMRN2
Gene Name: multimerin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024756.2	1114	Intron			NP_079032.2
XM_005270153.1	1114	Intron			XP_005270210.1
XM_006717970.3	1114	UTR 5			XP_006718033.1

Gene: SNCG
Gene Name: synuclein gamma

There are no transcripts associated with this gene.

View Full Product Details