Product Details

SNP ID: rs138336362
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65861979 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGCCCAAAGCGGGAGGCTCTGG[A/C]AGCTACTGGCCAGCTCGGCACTCAG
Phenotype: MIM: 601442 MIM: 604633 MIM: 606591
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CFL1 PubMed Links

Gene Details

Gene: CFL1
Gene Name: cofilin 1

There are no transcripts associated with this gene.

Gene: EFEMP2
Gene Name: EGF containing fibulin like extracellular matrix protein 2

There are no transcripts associated with this gene.

Gene: MUS81
Gene Name: MUS81 structure-specific endonuclease subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025128.4	552	Silent Mutation	GGA,GGC	G128G	NP_079404.3
XM_005274307.2	552	Silent Mutation	GGA,GGC	G128G	XP_005274364.1
XM_011545269.1	552	Silent Mutation	GGA,GGC	G128G	XP_011543571.1
XM_011545270.1	552	Silent Mutation	GGA,GGC	G128G	XP_011543572.1

Gene: SNX32
Gene Name: sorting nexin 32

There are no transcripts associated with this gene.

View Full Product Details