Product Details

SNP ID: rs141000255
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:111913791 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCTTAAACCTGGAAGCACCTCGG[A/G]GTGGCCGACATTTGGACACAGAGGT
Phenotype: MIM: 123590 MIM: 602179
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C11orf52 PubMed Links

Gene Details

Gene: C11orf52
Gene Name: chromosome 11 open reading frame 52

There are no transcripts associated with this gene.

Gene: CRYAB
Gene Name: crystallin alpha B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289807.1	539	Intron			NP_001276736.1
NM_001289808.1	539	Intron			NP_001276737.1
NM_001885.2	539	Intron			NP_001876.1
XM_011542608.1	539	Intron			XP_011540910.1
XM_011542609.2	539	Intron			XP_011540911.1

Gene: HSPB2
Gene Name: heat shock protein family B (small) member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001541.3	539	Missense Mutation	AGT,GGT	S149G	NP_001532.1

Gene: HSPB2-C11orf52
Gene Name: HSPB2-C11orf52 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details