Product Details

SNP ID: rs143257547
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:61875967 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTGTAGTTGTGTCTCGGCATCCT[G/T]GGGAAGAGGCTGGGGGTGGGGAGCG
Phenotype: MIM: 606149 MIM: 606150
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: FADS2 PubMed Links

Gene Details

Gene: FADS2
Gene Name: fatty acid desaturase 2

There are no transcripts associated with this gene.

Gene: FADS3
Gene Name: fatty acid desaturase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021727.4	1350	Silent Mutation	CCA,CCC	P390P	NP_068373.1
XM_011545023.2	1350	Silent Mutation	CCA,CCC	P399P	XP_011543325.1
XM_017017723.1	1350	Silent Mutation	CCA,CCC	P445P	XP_016873212.1
XM_017017724.1	1350	Silent Mutation	CCA,CCC	P436P	XP_016873213.1

Gene: MIR6746
Gene Name: microRNA 6746

There are no transcripts associated with this gene.

View Full Product Details