Product Details
- SNP ID
-
rs142303290
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:223172 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CACAGAGGGACTCGAAGATGGCCAC[A/G]AACAGGAGGCACATGCCACTGGCCG
- Phenotype
-
MIM: 603080
MIM: 615097
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
SLC6A12
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2289954] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- SLC6A12
- Gene Name
- solute carrier family 6 member 12
There are no transcripts associated with this gene.
- Gene
- SLC6A13
- Gene Name
- solute carrier family 6 member 13
View Full Product Details