Product Details

SNP ID: rs145515902
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:122981781 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGAAGAGGAAGAAGCTGAAGAAGA[A/C]GGGCAAGGAGAAGGCGGAAGCACAG
Phenotype: MIM: 605453 MIM: 607668 MIM: 608920
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ABCB9 PubMed Links

Gene Details

Gene: ABCB9
Gene Name: ATP binding cassette subfamily B member 9

There are no transcripts associated with this gene.

Gene: ARL6IP4
Gene Name: ADP ribosylation factor like GTPase 6 interacting protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002251.2	1044	Missense Mutation	AAG,ACG	K300T	NP_001002251.2
NM_001002252.2	1044	Missense Mutation	AAG,ACG	K289T	NP_001002252.2
NM_001278378.1	1044	Missense Mutation	AAG,ACG	K300T	NP_001265307.1
NM_001278379.1	1044	Missense Mutation	AAG,ACG	K169T	NP_001265308.1
NM_001278380.1	1044	Missense Mutation	AAG,ACG	K113T	NP_001265309.1
NM_016638.3	1044	Missense Mutation	AAG,ACG	K289T	NP_057722.3
NM_018694.3	1044	Missense Mutation	AAG,ACG	K308T	NP_061164.3

Gene: OGFOD2
Gene Name: 2-oxoglutarate and iron dependent oxygenase domain containing 2

There are no transcripts associated with this gene.

Gene: PITPNM2
Gene Name: phosphatidylinositol transfer protein membrane associated 2

There are no transcripts associated with this gene.

View Full Product Details