Product Details

SNP ID: rs145712498
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:55820289 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCTGGCCAGCTTCTATACCAAGT[A/G]TGATGCTGCGCACTTCCTCATCAAC
Phenotype: MIM: 606092 MIM: 610074 MIM: 610049
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJC14 PubMed Links

Gene Details

Gene: DNAJC14
Gene Name: DnaJ heat shock protein family (Hsp40) member C14

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032364.5	448	Intron			NP_115740.5

Gene: ORMDL2
Gene Name: ORMDL sphingolipid biosynthesis regulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014182.4	448	Missense Mutation	TAT,TGT	Y119C	NP_054901.1

Gene: SARNP
Gene Name: SAP domain containing ribonucleoprotein

There are no transcripts associated with this gene.

Gene: TMEM198B
Gene Name: transmembrane protein 198B (pseudogene)

There are no transcripts associated with this gene.

View Full Product Details