Product Details

SNP ID: rs148957106
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57727022 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGACGTGGGCGAGCTCGGCCGCCAG[A/G]TGGAGTGGGGAGCGCAGCTGTGGGT
Phenotype: MIM: 605476 MIM: 609677
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AGAP2 PubMed Links

Gene Details

Gene: AGAP2
Gene Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001122772.2	2410	Silent Mutation	CAC,CAT	H1096H	NP_001116244.1
NM_014770.3	2410	Silent Mutation	CAC,CAT	H740H	NP_055585.1
XM_005268625.3	2410	Silent Mutation	CAC,CAT	H1076H	XP_005268682.1
XM_005268626.2	2410	Silent Mutation	CAC,CAT	H760H	XP_005268683.1
XM_017018772.1	2410	Silent Mutation	CAC,CAT	H1096H	XP_016874261.1

Gene: AGAP2-AS1
Gene Name: AGAP2 antisense RNA 1

There are no transcripts associated with this gene.

Gene: OS9
Gene Name: OS9, endoplasmic reticulum lectin

There are no transcripts associated with this gene.

View Full Product Details