Product Details

SNP ID: rs143590067
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24190382 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCATGGAATAAAGGGAGGATACCT[A/G]AAAGGCAGGAAGCCTCCAACAGTCA
Phenotype: MIM: 608193
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IPO4 PubMed Links

Gene Details

Gene: IPO4
Gene Name: importin 4

There are no transcripts associated with this gene.

Gene: REC8
Gene Name: REC8 meiotic recombination protein

There are no transcripts associated with this gene.

Gene: TM9SF1
Gene Name: transmembrane 9 superfamily member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014842.2	1627	Silent Mutation	TTC,TTT	F475F	NP_001014842.1
NM_001289006.1	1627	Silent Mutation	TTC,TTT	F388F	NP_001275935.1
NM_006405.6	1627	Silent Mutation	TTC,TTT	F475F	NP_006396.2

View Full Product Details