Product Details
- SNP ID
-
rs149325199
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:36678950 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGGATGGATTAAAGGGTTAACTTTT[A/C]AAGATTATTATTGGTTAATGTTGAC
- Phenotype
-
MIM: 167416
MIM: 607571
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
PAX9
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs5807898] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PAX9
- Gene Name
- paired box 9
There are no transcripts associated with this gene.
- Gene
- SLC25A21
- Gene Name
- solute carrier family 25 member 21
View Full Product Details