Product Details

SNP ID: rs140813305
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:88606277 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCCGCGCTCTCTGTATGCCTTAA[C/T]AGGAGTGAGTGAAAGGGAAAGAGTG
Phenotype: MIM: 610177
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AEN PubMed Links

Gene Details

Gene: AEN
Gene Name: apoptosis enhancing nuclease

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022767.3		Intron			NP_073604.3
XM_005254966.1		Intron			XP_005255023.1
XM_005254967.1		Intron			XP_005255024.1
XM_006720645.3		Intron			XP_006720708.2
XM_011521905.2		Intron			XP_011520207.1
XM_017022489.1		Intron			XP_016877978.1
XM_017022490.1		Intron			XP_016877979.1

Gene: LINC01586
Gene Name: long intergenic non-protein coding RNA 1586

There are no transcripts associated with this gene.

Gene: MIR1179
Gene Name: microRNA 1179

There are no transcripts associated with this gene.

Gene: MIR3529
Gene Name: microRNA 3529

There are no transcripts associated with this gene.

Gene: MIR7-2
Gene Name: microRNA 7-2

There are no transcripts associated with this gene.

View Full Product Details