Product Details

SNP ID: rs144188544
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:28608326 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGATCCAACAGAGTCTGGGGGAGCA[C/G]AGCCAGGGGCAGGTGTGTCTTCAGG
Phenotype: MIM: 171150
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: SULT1A1 PubMed Links
Additional Information: The SULT1A1 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of SULT1A1. SULT1A1 SNP genotyping assays run on samples having 2 or more gene copies that are homozygous for the SNP allele will cluster together, and samples having more than 2 gene copies that are heterozygous may run between the 2 copy heterozygous and homozygous clusters. For accurate SULT1A1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001055.3	767	Silent Mutation	CTG,GTG	L113V	NP_001046.2
NM_177529.2	767	Silent Mutation	CTG,GTG	L113V	NP_803565.1
NM_177530.2	767	Silent Mutation	CTG,GTG	L113V	NP_803566.1
NM_177534.2	767	Silent Mutation	CTG,GTG	L113V	NP_803878.1
NM_177536.3	767	Intron			NP_803880.1
XM_017023604.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879093.1
XM_017023605.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879094.1
XM_017023606.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879095.1
XM_017023607.1	767	Silent Mutation	CTG,GTG	L204V	XP_016879096.1
XM_017023608.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879097.1
XM_017023609.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879098.1
XM_017023610.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879099.1
XM_017023611.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879100.1
XM_017023612.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879101.1
XM_017023613.1	767	Silent Mutation	CTG,GTG	L113V	XP_016879102.1