Product Details
- SNP ID
-
rs146632606
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:56867150 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGACTGATGGGCTGGTGGAGGGCGA[C/G]GCAGGCACCAGCAGCGAGAAGAACC
- Phenotype
-
MIM: 613395
MIM: 600968
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR138-2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2304479] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR138-2
- Gene Name
- microRNA 138-2
There are no transcripts associated with this gene.
- Gene
- SLC12A3
- Gene Name
- solute carrier family 12 member 3
View Full Product Details