Product Details

SNP ID: rs146731658
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:27461458 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAAAGCCATGGGGCTCTCGTCCAG[C/G]CTGGAGGGCACTTCCACCTCTTCCA
Phenotype: MIM: 603246 MIM: 605383
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: GTF3C1 PubMed Links

Gene Details

Gene: GTF3C1
Gene Name: general transcription factor IIIC subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286242.1	6069	Silent Mutation	AGC,AGG	S2049R	NP_001273171.1
NM_001520.3	6069	Silent Mutation	AGC,AGG	S2074R	NP_001511.2
XM_017023188.1	6069	Silent Mutation	AGC,AGG	S2011R	XP_016878677.1

Gene: IL21R
Gene Name: interleukin 21 receptor

There are no transcripts associated with this gene.

Gene: IL21R-AS1
Gene Name: IL21R antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details