Product Details

SNP ID: rs150936688
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.16:75204224 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTTGGCGACACGGGCGTACACAGC[A/G]GGCGTGGTGGTAGAGCAGGTGCGGC
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: CTRB2 PubMed Links
Additional Information: For this assay, SNP(s) [rs4737] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001025200.3	762	Silent Mutation			NP_001020371.3