Product Details

SNP ID: rs140033860
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42574156 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTGCACCTTAGCAGTGAGGGCCA[C/T]GATTTTGCCATCTAGGACTTGAAGG
Phenotype: MIM: 609855 MIM: 616498 MIM: 602976 MIM: 608665
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COASY PubMed Links

Gene Details

Gene: COASY
Gene Name: Coenzyme A synthase

There are no transcripts associated with this gene.

Gene: FAM134C
Gene Name: family with sequence similarity 134 member C

There are no transcripts associated with this gene.

Gene: MLX
Gene Name: MLX, MAX dimerization protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_170607.2	425	Intron			NP_733752.1
NM_198204.1	425	Intron			NP_937847.1
NM_198205.1	425	Intron			NP_937848.1
XM_017024991.1	425	Intron			XP_016880480.1

Gene: PSMC3IP
Gene Name: PSMC3 interacting protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256014.1	425	Missense Mutation	ATG,GTG	M31V	NP_001242943.1
NM_001256015.1	425	Missense Mutation	ATG,GTG	M15V	NP_001242944.1
NM_001256016.1	425	Missense Mutation	ATG,GTG	M15V	NP_001242945.1
NM_013290.6	425	Missense Mutation	ATG,GTG	M94V	NP_037422.2
NM_016556.3	425	Missense Mutation	ATG,GTG	M94V	NP_057640.1

View Full Product Details