Product Details

SNP ID: rs141082701
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:50548338 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCGACGGTCAGTAGTTCAGTGCCC[A/G]TGCCTGCTGGAGGGAAAGGAAGCCA
Phenotype: MIM: 607264 MIM: 613939
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CACNA1G-AS1 PubMed Links

Gene Details

Gene: CACNA1G-AS1
Gene Name: CACNA1G antisense RNA 1

There are no transcripts associated with this gene.

Gene: EPN3
Gene Name: epsin 3

There are no transcripts associated with this gene.

Gene: LOC105371824
Gene Name: uncharacterized LOC105371824

There are no transcripts associated with this gene.

Gene: SPATA20
Gene Name: spermatogenesis associated 20

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258372.1	253	Missense Mutation	ATG,GTG	M45V	NP_001245301.1
NM_001258373.1	253	Missense Mutation	ATG,GTG	M1V	NP_001245302.1
NM_022827.3	253	Missense Mutation	ATG,GTG	M61V	NP_073738.2

View Full Product Details