Product Details

SNP ID: rs147086735
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7353398 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGTGGGGATAGGGCAGAGGGGAG[C/T]CCACATTTTCATCTGGAGTGGGCCC
Phenotype: MIM: 607763 MIM: 609848
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACAP1 PubMed Links

Gene Details

Gene: ACAP1
Gene Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014716.3	1510	Intron			NP_055531.1

Gene: KCTD11
Gene Name: potassium channel tetramerization domain containing 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002914.2	1510	Silent Mutation	AGC,AGT	S152S	NP_001002914.1

Gene: TMEM95
Gene Name: transmembrane protein 95

There are no transcripts associated with this gene.

View Full Product Details