Product Details

SNP ID: rs147169833
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42126774 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGACCTATTGCCATGAAGATTTC[A/G]TTCACGTTCATTGCAGTCTTTGCTG
Phenotype: MIM: 608344 MIM: 602301 MIM: 604037
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HSPB9 PubMed Links

Gene Details

Gene: HSPB9
Gene Name: heat shock protein family B (small) member 9

There are no transcripts associated with this gene.

Gene: KAT2A
Gene Name: lysine acetyltransferase 2A

There are no transcripts associated with this gene.

Gene: RAB5C
Gene Name: RAB5C, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252039.1	695	Silent Mutation	AAC,AAT	N205N	NP_001238968.1
NM_004583.3	695	Silent Mutation	AAC,AAT	N172N	NP_004574.2
NM_201434.2	695	Silent Mutation	AAC,AAT	N172N	NP_958842.1
XM_011525090.1	695	Silent Mutation	AAC,AAT	N172N	XP_011523392.1
XM_011525091.1	695	Silent Mutation	AAC,AAT	N172N	XP_011523393.1

View Full Product Details