Product Details
- SNP ID
-
rs147217839
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:4780793 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACAATGACTCTTGTCCCACAGGTAC[C/T]GTGTCCGGGGATTGCAGCCGTTCGG
- Phenotype
-
MIM: 604657
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
GLTPD2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs13520] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GLTPD2
- Gene Name
- glycolipid transfer protein domain containing 2
There are no transcripts associated with this gene.
- Gene
- TM4SF5
- Gene Name
- transmembrane 4 L six family member 5
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_003963.2 |
213 |
Missense Mutation |
CCG,CTG |
P61L |
NP_003954.2 |
- Gene
- VMO1
- Gene Name
- vitelline membrane outer layer 1 homolog
There are no transcripts associated with this gene.
View Full Product Details