Product Details
- SNP ID
-
rs141511927
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:43194550 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GACAAGTAGAGGTTTTCTCCTGAAC[A/G]GTAATAGGTGAATGAAGGGTAAATG
- Phenotype
-
MIM: 176393
MIM: 176394
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PSG4
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs56022011] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PSG4
- Gene Name
- pregnancy specific beta-1-glycoprotein 4
- Gene
- PSG5
- Gene Name
- pregnancy specific beta-1-glycoprotein 5
There are no transcripts associated with this gene.
View Full Product Details