Product Details

SNP ID: rs141522530
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:10836827 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAGTGCGGCTGTGAGAATTGAGATG[A/C]GGCTTGGTTCATATTGAGTGCTCAG
Phenotype: MIM: 602378 MIM: 605395
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: C19orf38 PubMed Links

Gene Details

Gene: C19orf38
Gene Name: chromosome 19 open reading frame 38

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136482.1	256	Intron			NP_001129954.1
XM_005259846.4	256	UTR 5			XP_005259903.1
XM_005259847.4	256	Intron			XP_005259904.1

Gene: DNM2
Gene Name: dynamin 2

There are no transcripts associated with this gene.

Gene: MIR6793
Gene Name: microRNA 6793

There are no transcripts associated with this gene.

Gene: TMED1
Gene Name: transmembrane p24 trafficking protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006858.3	256	Intron			NP_006849.1
XM_006722631.3	256	Intron			XP_006722694.1

View Full Product Details