Product Details
- SNP ID
-
rs144170438
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:56813264 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCTCTGCAGAGTAAACTGTAACTGT[A/G]TATCATATAAATCCAAATATATGTG
- Phenotype
-
MIM: 601483
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PEG3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs35563894] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PEG3
- Gene Name
- paternally expressed 3
- Gene
- PEG3-AS1
- Gene Name
- PEG3 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- ZIM2
- Gene Name
- zinc finger imprinted 2
View Full Product Details