Product Details

SNP ID: rs148740674
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:42078756 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCACTTTGAGCTGGTGGGCGTGGC[G/T]GATCCCGGAGTCACTGTGGCCACAG
Phenotype: MIM: 600283 MIM: 164176
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: GRIK5 PubMed Links

Gene Details

Gene: GRIK5
Gene Name: glutamate ionotropic receptor kainate type subunit 5

There are no transcripts associated with this gene.

Gene: POU2F2
Gene Name: POU class 2 homeobox 2

There are no transcripts associated with this gene.

Gene: ZNF574
Gene Name: zinc finger protein 574

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022752.5	182	Silent Mutation	GCG,GCT	A50A	NP_073589.4
XM_005259159.2	182	Silent Mutation	GCG,GCT	A50A	XP_005259216.1
XM_011527228.2	182	Silent Mutation	GCG,GCT	A50A	XP_011525530.1
XM_011527229.2	182	Silent Mutation	GCG,GCT	A50A	XP_011525531.1
XM_011527230.2	182	Silent Mutation	GCG,GCT	A50A	XP_011525532.1
XM_017027149.1	182	Silent Mutation	GCG,GCT	A140A	XP_016882638.1

View Full Product Details