Product Details

SNP ID: rs149199108
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:12675618 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGCCTGCTGACCGCCATGGGAGG[A/C]AGCGTCCAGTGCTGGCGAGAGGAGG
Phenotype: MIM: 600944 MIM: 609458 MIM: 616850
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: DHPS PubMed Links

Gene Details

Gene: DHPS
Gene Name: deoxyhypusine synthase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206974.1	1278	Intron			NP_001193903.1
NM_001930.3	1278	Intron			NP_001921.1
NM_013406.2	1278	Intron			NP_037538.1
XM_011527770.1	1278	UTR 3			XP_011526072.1
XM_011527771.2	1278	Intron			XP_011526073.1

Gene: MAN2B1
Gene Name: mannosidase alpha class 2B member 1

There are no transcripts associated with this gene.

Gene: WDR83
Gene Name: WD repeat domain 83

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099737.2	1278	Silent Mutation	GGA,GGC	G298G	NP_001093207.1
NM_032332.3	1278	Silent Mutation	GGA,GGC	G298G	NP_115708.1

Gene: WDR83OS
Gene Name: WD repeat domain 83 opposite strand

There are no transcripts associated with this gene.

View Full Product Details