Product Details

SNP ID: rs113744947
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:156738658 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCATCCCATAGCGGTAATGGGGG[G/T]GCAGAGTGACCTTGGATGCCAAGGC
Phenotype: MIM: 600339 MIM: 611836
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: HDGF PubMed Links

Gene Details

Gene: HDGF
Gene Name: hepatoma-derived growth factor

There are no transcripts associated with this gene.

Gene: MRPL24
Gene Name: mitochondrial ribosomal protein L24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024540.3	297	Missense Mutation			NP_078816.2
NM_145729.2	297	Missense Mutation			NP_663781.1
XM_011509981.2	297	Missense Mutation			XP_011508283.1
XM_011509982.2	297	Missense Mutation			XP_011508284.1

Gene: RRNAD1
Gene Name: ribosomal RNA adenine dimethylase domain containing 1

There are no transcripts associated with this gene.

View Full Product Details