Product Details

SNP ID: rs113928928
Assay Type: Functionally tested
NCBI dbSNP Submissions: 1
Location: Chr.1:43364426 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACAGGTACATTATGACATGCACGGA[A/G]GAGTTTATCATGGCATGGAAAGAGC
Phenotype: MIM: 603618 MIM: 611813 MIM: 159530
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CDC20 PubMed Links

Gene Details

Gene: CDC20
Gene Name: cell division cycle 20

There are no transcripts associated with this gene.

Gene: ELOVL1
Gene Name: ELOVL fatty acid elongase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256399.1	499	Silent Mutation	TCC,TCT	S172S	NP_001243328.1
NM_001256401.1	499	Silent Mutation	TCC,TCT	S145S	NP_001243330.1
NM_001256402.1	499	Silent Mutation	TCC,TCT	S91S	NP_001243331.1
NM_022821.3	499	Silent Mutation	TCC,TCT	S172S	NP_073732.1

Gene: MIR6734
Gene Name: microRNA 6734

There are no transcripts associated with this gene.

Gene: MPL
Gene Name: MPL proto-oncogene, thrombopoietin receptor

There are no transcripts associated with this gene.

View Full Product Details