Product Details
- SNP ID
-
rs140542533
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
10
- Location
-
Chr.1:248650209 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTCCCCTCTGCCTCGCTCATCCTAT[A/G]AACAGTAATGAGAATTCTTGTGTAA
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR2T10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs78776291] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR2T10
- Gene Name
- olfactory receptor family 2 subfamily T member 10
There are no transcripts associated with this gene.
- Gene
- OR2T27
- Gene Name
- olfactory receptor family 2 subfamily T member 27
View Full Product Details