Product Details

SNP ID: rs140797137
Assay Type: Functionally tested
NCBI dbSNP Submissions: 16
Location: Chr.1:156595464 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCTCTTCTTTTTCTTCCCTTTCC[C/T]GAGGGACTGATTGGTTTGCTCTCTG
Phenotype: MIM: 608862
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GPATCH4 PubMed Links

Gene Details

Gene: GPATCH4
Gene Name: G-patch domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015590.3	921	Missense Mutation	AGG,GGG	R293G	NP_056405.2
NM_182679.2	921	Missense Mutation	AGG,GGG	R288G	NP_872620.1
XM_005245287.3	921	Missense Mutation	AGG,GGG	R259G	XP_005245344.1

Gene: HAPLN2
Gene Name: hyaluronan and proteoglycan link protein 2

There are no transcripts associated with this gene.

Gene: NAXE
Gene Name: NAD(P)HX epimerase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144772.2	921	Intron			NP_658985.2
XM_017000319.1	921	Intron			XP_016855808.1

Gene: TTC24
Gene Name: tetratricopeptide repeat domain 24

There are no transcripts associated with this gene.

View Full Product Details